Stem-loop sequence dme-mir-983-1

AccessionMI0005840 (change log)
DescriptionDrosophila melanogaster miR-983-1 stem-loop
Gene family MIPF0000450; mir-983
Literature search

4 open access papers mention dme-mir-983-1
(15 sentences)

Stem-loop
   -uaua            a     a   uu gaa       uuuuc 
5'      uugcaauaauua auaau cgu  c   cuaauga     a
        |||||||||||| ||||| |||  |   |||||||      
3'      aauguuguugau uauua gca  g   gauuacu     g
   uuaca            c     c   uu aug       uacuu 
Get sequence
Deep sequencing
1955 reads, 66.7 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 4368309-4368399 [-]
antisense
FBtr0070652 ; CG3626-RA; intron 1
Clustered miRNAs
< 10kb from dme-mir-983-1
dme-mir-984chrX: 4368646-4368735 [-]
dme-mir-983-2chrX: 4368483-4368581 [-]
dme-mir-983-1chrX: 4368309-4368399 [-]
dme-mir-303chrX: 4366179-4366248 [-]
dme-mir-982chrX: 4365806-4365898 [-]
Database links

Mature sequence dme-miR-983-5p

Accession MIMAT0005499
Previous IDsdme-miR-983
Sequence

18 - 

auaauacguuucgaacuaauga

 - 39

Get sequence
Deep sequencing2888 reads, 44 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-983-3p

Accession MIMAT0020880
Sequence

54 - 

auuagguaguuacgcauuaucu

 - 75

Get sequence
Deep sequencing972 reads, 31 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).