Stem-loop sequence dme-mir-984

AccessionMI0005842 (change log)
DescriptionDrosophila melanogaster miR-984 stem-loop
Literature search

3 open access papers mention dme-mir-984
(6 sentences)

Stem-loop
   ---a    ca      a     g     a        a  -uu  cu 
5'     gaaa  aauuuc uugag uaaau cgguugga uu   gu  u
       ||||  |||||| ||||| ||||| |||||||| ||   ||   
3'     cuuu  uuaaag ggcuc guuua gccaaccu aa   ca  u
   uuga    --      c     g     a        a  uau  au 
Get sequence
Deep sequencing
5286 reads, 386 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 4368646-4368735 [-]
antisense
FBtr0070652 ; CG3626-RA; intron 1
Clustered miRNAs
< 10kb from dme-mir-984
dme-mir-984chrX: 4368646-4368735 [-]
dme-mir-983-2chrX: 4368483-4368581 [-]
dme-mir-983-1chrX: 4368309-4368399 [-]
dme-mir-303chrX: 4366179-4366248 [-]
dme-mir-982chrX: 4365806-4365898 [-]
Database links

Mature sequence dme-miR-984-5p

Accession MIMAT0005500
Previous IDsdme-miR-984
Sequence

16 - 

ugagguaaauacgguuggaauuu

 - 38

Get sequence
Deep sequencing5053 reads, 49 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-984-3p

Accession MIMAT0020881
Sequence

55 - 

auccaaccgaauuuggcucg

 - 74

Get sequence
Deep sequencing226 reads, 32 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).