Stem-loop sequence dme-mir-985

AccessionMI0005844 (change log)
DescriptionDrosophila melanogaster miR-985 stem-loop
Literature search

3 open access papers mention dme-mir-985
(5 sentences)

Stem-loop
   ---uau        a     g cu      u      c       
5'       auaauagc cugcu g  cauugg acauuu auaagu 
         |||||||| ||||| |  |||||| |||||| ||||| a
3'       uauuaucg gacgg c  guaacc uguaaa uauucc 
   ccuguu        a     g ug      u      c       
Get sequence
Deep sequencing
619 reads, 63 reads per million, 27 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 16191254-16191339 [-]
intergenic
Database links

Mature sequence dme-miR-985-5p

Accession MIMAT0020883
Sequence

16 - 

cuggcucauugguacauuucau

 - 37

Get sequence
Deep sequencing42 reads, 3 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-985-3p

Accession MIMAT0005502
Previous IDsdme-miR-985
Sequence

49 - 

caaauguuccaauggucgggca

 - 70

Get sequence
Deep sequencing576 reads, 27 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).