Stem-loop sequence dme-mir-986

AccessionMI0005845 (change log)
DescriptionDrosophila melanogaster miR-986 stem-loop
Gene family MIPF0000860; mir-986
Literature search

6 open access papers mention dme-mir-986
(20 sentences)

Stem-loop
   caca  ug    u   cau  c       g    ga     guaacug    
5'     cc  aaau acc   cu gaauagc uugu  cugag       cgc 
       ||  |||| |||   || ||||||| ||||  |||||       || a
3'     gg  uuua ugg   ga cuuaucg agcg  gacuc       gcu 
   --cc  gu    u   aau  a       g    gc     -aucuaa    
Get sequence
Deep sequencing
247999 reads, 1.2e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 8444982-8445081 [+]
sense
FBtr0088745 ; Cyp4e2-RA; intron 1
Database links

Mature sequence dme-miR-986-5p

Accession MIMAT0005503
Previous IDsdme-miR-986
Sequence

19 - 

ucucgaauagcguugugacuga

 - 40

Get sequence
Deep sequencing247555 reads, 49 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-986-3p

Accession MIMAT0020884
Sequence

65 - 

agcggcgaggcuauucaaguaa

 - 86

Get sequence
Deep sequencing421 reads, 42 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).