Stem-loop sequence dme-mir-987

AccessionMI0005846 (change log)
DescriptionDrosophila melanogaster miR-987 stem-loop
Gene family MIPF0000859; mir-987
Literature search

2 open access papers mention dme-mir-987
(8 sentences)

Stem-loop
   -  - ug      gu  a        a     gau       ag  gc 
5'  ug u  gacugu  uu aaguaaau gucug   ugaugaa  uu  a
    || |  ||||||  || |||||||| |||||   |||||||  ||  u
3'  ac a  uugacg  aa uucauuua cggac   acuacuu  ga  u
   a  a gu      uc  c        -     --a       aa  gc 
Get sequence
Deep sequencing
217530 reads, 1.48e+03 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 9313023-9313116 [-]
sense
FBtr0088558 ; CG13739-RA; intron 3
FBtr0332996 ; CG13954-RC; intron 7
FBtr0332997 ; CG13954-RD; intron 7
Database links

Mature sequence dme-miR-987-5p

Accession MIMAT0005504
Previous IDsdme-miR-987
Sequence

15 - 

uaaaguaaauagucuggauugaug

 - 38

Get sequence
Deep sequencing217343 reads, 44 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-987-3p

Accession MIMAT0020885
Sequence

59 - 

aucaacaggcauuuacuuca

 - 78

Get sequence
Deep sequencing177 reads, 23 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).