Stem-loop sequence dme-mir-990

AccessionMI0005850 (change log)
DescriptionDrosophila melanogaster miR-990 stem-loop
Literature search

1 open access papers mention dme-mir-990
(1 sentences)

Stem-loop
   uc     --u c  c  -u     -uu    --        - aag 
5'   ugcuc   g ga au  caccg   cuga  guuggccc c   u
     |||||   | || ||  |||||   ||||  |||||||| |    
3'   acgag   c cu ua  guggc   gacu  cgaccggg g   g
   -c     ccc a  u  cc     uuc    uu        u cac 
Get sequence
Deep sequencing
7850 reads, 87.5 reads per million, 40 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 16895223-16895308 [-]
sense
FBtr0087071 ; CG8910-RA; intron 1
Database links

Mature sequence dme-miR-990-5p

Accession MIMAT0005508
Previous IDsdme-miR-990
Sequence

14 - 

auucaccguucugaguuggcc

 - 34

Get sequence
Deep sequencing7780 reads, 37 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-990-3p

Accession MIMAT0020889
Sequence

49 - 

gccagcuuucagcuucggugccau

 - 72

Get sequence
Deep sequencing68 reads, 12 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).