Stem-loop sequence dme-mir-991

AccessionMI0005851 (change log)
DescriptionDrosophila melanogaster miR-991 stem-loop
Gene family MIPF0000957; mir-991
Literature search

1 open access papers mention dme-mir-991
(2 sentences)

Stem-loop
   uaucac     uu     c      c       c  a      cauauu 
5'       ugcag  ucagg uuuucc aacuaca cu uuaaua      u
         |||||  ||||| |||||| ||||||| || ||||||      u
3'       acguu  gguuu gaaagg uugaugu ga aauuau      a
   ----uu     uu     u      u       u  -      ccugca 
Get sequence
Deep sequencing
1924 reads, 26.8 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 20585200-20585295 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-991
dme-mir-992chr2R: 20585314-20585405 [-]
dme-mir-991chr2R: 20585200-20585295 [-]
dme-mir-2498chr2R: 20584709-20584820 [-]
dme-mir-313chr2R: 20584190-20584260 [-]
dme-mir-312chr2R: 20584056-20584121 [-]
dme-mir-311chr2R: 20583877-20583960 [-]
dme-mir-310chr2R: 20583752-20583840 [-]
Database links

Mature sequence dme-miR-991-5p

Accession MIMAT0020890
Sequence

21 - 

uuucccaacuacaccuauuaau

 - 42

Get sequence
Deep sequencing29 reads, 6 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-991-3p

Accession MIMAT0005509
Previous IDsdme-miR-991
Sequence

61 - 

uuaaaguuguaguuuggaaagu

 - 82

Get sequence
Deep sequencing1895 reads, 41 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).