Stem-loop sequence dme-mir-992

AccessionMI0005852 (change log)
DescriptionDrosophila melanogaster miR-992 stem-loop
Gene family MIPF0000914; mir-992
Literature search

3 open access papers mention dme-mir-992
(6 sentences)

Stem-loop
   ----      - c      c         caaa    uauu      gu 
5'     auuuuc c aagugc ugguaucag    gugu    uuuuau  u
       |||||| | |||||| |||||||||    ||||    ||||||   
3'     ugaaag g uucaug aucaugguc    caca    gaaaug  u
   ccau      a c      a         uuug    ---u      ua 
Get sequence
Deep sequencing
3295 reads, 652 reads per million, 21 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 20585314-20585405 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-992
dme-mir-992chr2R: 20585314-20585405 [-]
dme-mir-991chr2R: 20585200-20585295 [-]
dme-mir-2498chr2R: 20584709-20584820 [-]
dme-mir-313chr2R: 20584190-20584260 [-]
dme-mir-312chr2R: 20584056-20584121 [-]
dme-mir-311chr2R: 20583877-20583960 [-]
dme-mir-310chr2R: 20583752-20583840 [-]
Database links

Mature sequence dme-miR-992-5p

Accession MIMAT0020891
Sequence

16 - 

ugguaucagcaaaguguuauuu

 - 37

Get sequence
Deep sequencing127 reads, 8 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-992-3p

Accession MIMAT0005510
Previous IDsdme-miR-992
Sequence

53 - 

aguacacguuucugguacuaag

 - 74

Get sequence
Deep sequencing3158 reads, 22 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).