Stem-loop sequence dme-mir-929

Accession MI0005853
Description Drosophila melanogaster miR-929 stem-loop
Gene family MIPF0000447; mir-929
Stem-loop 
--ag    gg  g       a        ag         -   u 
    uccu  ug agcucaa uugacucu  uagggaguc cuu a
    ||||  || ||||||| ||||||||  ||||||||| |||  
    agga  ac ucgaguu gacugagg  aucccucag gag a
agcg    -a  g       a        ca         c   u
Get sequence
Deep sequencing
5941 reads, 42 experiments
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
3R: 121091-121178 [+]
sense
FBtr0113337 ; cpx-RL; intron 2
FBtr0100500 ; cpx-RK; intron 2
FBtr0100499 ; cpx-RJ; intron 2
FBtr0078902 ; cpx-RE; intron 2
FBtr0113337 ; cpx-RL; intron 2
FBtr0100500 ; cpx-RK; intron 2
FBtr0100499 ; cpx-RJ; intron 2
FBtr0078902 ; cpx-RE; intron 2
FBtr0113337 ; cpx-RL; intron 2
FBtr0100500 ; cpx-RK; intron 2
FBtr0100499 ; cpx-RJ; intron 2
FBtr0078902 ; cpx-RE; intron 2
FBtr0078901 ; cpx-RA; intron 3
FBtr0078901 ; cpx-RA; intron 3
FBtr0078901 ; cpx-RA; intron 3
FBtr0113339 ; cpx-RN; intron 4
FBtr0301770 ; cpx-RW; intron 4
FBtr0078899 ; cpx-RH; intron 4
FBtr0301771 ; cpx-RX; intron 4
FBtr0301772 ; cpx-RY; intron 4
FBtr0113338 ; cpx-RM; intron 4
FBtr0078900 ; cpx-RC; intron 4
FBtr0078898 ; cpx-RI; intron 4
FBtr0301769 ; cpx-RV; intron 4
FBtr0113341 ; cpx-RP; intron 4
FBtr0113340 ; cpx-RO; intron 4
FBtr0078897 ; cpx-RG; intron 4
FBtr0113339 ; cpx-RN; intron 4
FBtr0301770 ; cpx-RW; intron 4
FBtr0078899 ; cpx-RH; intron 4
FBtr0301771 ; cpx-RX; intron 4
FBtr0301772 ; cpx-RY; intron 4
FBtr0113338 ; cpx-RM; intron 4
FBtr0078900 ; cpx-RC; intron 4
FBtr0078898 ; cpx-RI; intron 4
FBtr0301769 ; cpx-RV; intron 4
FBtr0113341 ; cpx-RP; intron 4
FBtr0113340 ; cpx-RO; intron 4
FBtr0078897 ; cpx-RG; intron 4
FBtr0113339 ; cpx-RN; intron 4
FBtr0301770 ; cpx-RW; intron 4
FBtr0078899 ; cpx-RH; intron 4
FBtr0301771 ; cpx-RX; intron 4
FBtr0301772 ; cpx-RY; intron 4
FBtr0113338 ; cpx-RM; intron 4
FBtr0078900 ; cpx-RC; intron 4
FBtr0078898 ; cpx-RI; intron 4
FBtr0301769 ; cpx-RV; intron 4
FBtr0113341 ; cpx-RP; intron 4
FBtr0113340 ; cpx-RO; intron 4
FBtr0078897 ; cpx-RG; intron 4
FBtr0300790 ; cpx-RT; intron 5
FBtr0300789 ; cpx-RS; intron 5
FBtr0113343 ; cpx-RR; intron 5
FBtr0301768 ; cpx-RU; intron 5
FBtr0300790 ; cpx-RT; intron 5
FBtr0300789 ; cpx-RS; intron 5
FBtr0113343 ; cpx-RR; intron 5
FBtr0301768 ; cpx-RU; intron 5
FBtr0300790 ; cpx-RT; intron 5
FBtr0300789 ; cpx-RS; intron 5
FBtr0113343 ; cpx-RR; intron 5
FBtr0301768 ; cpx-RU; intron 5

Mature sequence dme-miR-929-5p

Accession MIMAT0020892
Sequence

17 -  

aaauugacucuaguagggaguc

 - 38

Get sequence
Deep sequencing 1177 reads, 39 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-929-3p

Accession MIMAT0005511
Previous IDs dme-miR-929
Sequence

52 -  

cucccuaacggagucagauug

 - 72

Get sequence
Deep sequencing 4764 reads, 38 experiments
Evidence experimental; 454 [1-2], Solexa [2]
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).