Stem-loop sequence dme-mir-929

AccessionMI0005853 (change log)
DescriptionDrosophila melanogaster miR-929 stem-loop
Gene family MIPF0000447; mir-929
Literature search

1 open access papers mention dme-mir-929
(1 sentences)

Stem-loop
   --ag    gg  g       a        ag         -   u 
5'     uccu  ug agcucaa uugacucu  uagggaguc cuu a
       ||||  || ||||||| ||||||||  ||||||||| |||  
3'     agga  ac ucgaguu gacugagg  aucccucag gag a
   agcg    -a  g       a        ca         c   u 
Get sequence
Deep sequencing
5110 reads, 61.7 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 4295369-4295456 [+]
sense
FBtr0100500 ; cpx-RK; intron 2
FBtr0310614 ; cpx-RAA; intron 2
FBtr0113337 ; cpx-RL; intron 2
FBtr0310506 ; cpx-RZ; intron 2
FBtr0100499 ; cpx-RJ; intron 2
FBtr0078901 ; cpx-RA; intron 3
FBtr0078897 ; cpx-RG; intron 4
FBtr0301769 ; cpx-RV; intron 4
FBtr0078898 ; cpx-RI; intron 4
FBtr0078899 ; cpx-RH; intron 4
FBtr0078900 ; cpx-RC; intron 4
FBtr0078902 ; cpx-RE; intron 4
FBtr0113338 ; cpx-RM; intron 4
FBtr0113340 ; cpx-RO; intron 4
FBtr0301770 ; cpx-RW; intron 4
FBtr0113339 ; cpx-RN; intron 4
FBtr0113341 ; cpx-RP; intron 4
FBtr0301771 ; cpx-RX; intron 4
FBtr0301772 ; cpx-RY; intron 4
FBtr0113343 ; cpx-RR; intron 5
FBtr0301768 ; cpx-RU; intron 5
FBtr0300789 ; cpx-RS; intron 5
Database links

Mature sequence dme-miR-929-5p

Accession MIMAT0020892
Sequence

17 - 

aaauugacucuaguagggaguc

 - 38

Get sequence
Deep sequencing2377 reads, 46 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-929-3p

Accession MIMAT0005511
Previous IDsdme-miR-929
Sequence

52 - 

cucccuaacggagucagauug

 - 72

Get sequence
Deep sequencing2732 reads, 46 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).