Stem-loop sequence dme-mir-993

AccessionMI0005854 (change log)
DescriptionDrosophila melanogaster miR-993 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention dme-mir-993
(5 sentences)

Stem-loop
   aacg  -   -    cc    c     uuc          ----uuuaaa    -       a 
5'     cu ccc guga  uacc uguag   cgggcuuuug          uggc guucggc c
       || ||| ||||  |||| |||||   ||||||||||          |||| ||||||| a
3'     ga ggg cacu  augg acauc   gcucgaagac          gucg caggcug u
   --aa  u   a    cu    -     ucu          uauuagcucg    u       u 
Get sequence
Deep sequencing
93538 reads, 826 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 6776333-6776451 [+]
sense
FBtr0303008 ; CR42721-RA; intron 1
FBtr0309069 ; CR42721-RB; exon 2
Database links

Mature sequence dme-miR-993-5p

Accession MIMAT0020893
Sequence

16 - 

uacccuguaguuccgggcuuuug

 - 38

Get sequence
Deep sequencing13231 reads, 45 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-993-3p

Accession MIMAT0005512
Previous IDsdme-miR-993
Sequence

85 - 

gaagcucgucucuacagguaucu

 - 107

Get sequence
Deep sequencing80303 reads, 47 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).