Stem-loop sequence dme-mir-995

AccessionMI0005856 (change log)
DescriptionDrosophila melanogaster miR-995 stem-loop
Gene family MIPF0000895; mir-995
Literature search

4 open access papers mention dme-mir-995
(15 sentences)

Stem-loop
   --ca    c   c  c    c           ga      cc   u 
5'     ccug acc cg agcc gaauuaugugg  gcugcg  guu c
       |||| ||| || |||| |||||||||||  ||||||  ||| c
3'     ggac ugg gc ucgg cuuaguacacc  cgaugc  uaa g
   uaua    a   u  u    -           -a      -c   u 
Get sequence
Deep sequencing
240907 reads, 3.37e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 20735923-20736012 [+]
sense
FBtr0300447 ; cdc2c-RC; intron 1
FBtr0083921 ; cdc2c-RA; intron 1
FBtr0083922 ; cdc2c-RB; intron 1
Database links

Mature sequence dme-miR-995-5p

Accession MIMAT0010206
Previous IDsdme-miR-995*
Sequence

17 - 

cccgaauuaugugggagcugcg

 - 38

Get sequence
Deep sequencing5057 reads, 49 experiments
Evidence experimental; 454 [3]
Database links
Predicted targets

Mature sequence dme-miR-995-3p

Accession MIMAT0005514
Previous IDsdme-miR-995
Sequence

55 - 

uagcaccacaugauucggcuu

 - 75

Get sequence
Deep sequencing235832 reads, 49 experiments
Evidence experimental; 454 [1-3], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).
3
PMID:18463636 "Drosophila endogenous small RNAs bind to Argonaute 2 in somatic cells" Kawamura Y, Saito K, Kin T, Ono Y, Asai K, Sunohara T, Okada TN, Siomi MC, Siomi H Nature. 453:793-797(2008).