|
miRBase |
|
Stem-loop sequence dme-mir-996 |
||||||
| Accession | MI0005857 | |||||
| Description | Drosophila melanogaster miR-996 stem-loop | |||||
| Gene family | MIPF0000449; mir-996 | |||||
| Stem-loop |
u u u c a - g ugguuca cugacuc auuu gu ggcga caugga ucuagu cacgg u ||||||| |||| || ||||| |||||| |||||| ||||| gacuggg ugaa ua cugcu guacuu agauca gugcu g - u u u c u - ugaauua |
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence dme-miR-996-5p |
|
| Accession | MIMAT0020895 |
| Sequence |
19 - gcgaacauggaucuagugcacg - 40 |
| Deep sequencing | 31221 reads, 50 experiments |
| Evidence | not experimental |
| Predicted targets |
|
Mature sequence dme-miR-996-3p |
|
| Accession | MIMAT0005515 |
| Previous IDs | dme-miR-996 |
| Sequence |
61 - ugacuagauuucaugcucgucu - 82 |
| Deep sequencing | 1247850 reads, 50 experiments |
| Evidence | experimental; 454 [1-2], Solexa [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 2 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|