Stem-loop sequence dme-mir-997

AccessionMI0005859 (change log)
DescriptionDrosophila melanogaster miR-997 stem-loop
Literature search

2 open access papers mention dme-mir-997
(2 sentences)

Stem-loop
   uuaug     --ucu       aau        cc    c     g         c  ca          ag  --       a   a      c aaa     u   au 
5'      gaucc     uucaaug   uuaguaug  caaa ucgaa gaguuucac uc  uaagagcgac  uc  cuggaga guu ucagag c   aaaau cau  g
        |||||     |||||||   ||||||||  |||| ||||| ||||||||| ||  ||||||||||  ||  ||||||| ||| |||||| |   ||||| |||   
3'      cuagg     agguuac   aaucauac  guuu agcuu cucaaagug ag  auuuuuguug  ag  gacuucu caa agucuc g   uuuua gua  a
   -acgg     uucgu       agc        ua    u     a         a  cg          -a  ac       g   a      u -cc     c   gu 
Get sequence
Deep sequencing
621 reads, 117 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 19326954-19327168 [-]
intergenic
Database links

Mature sequence dme-miR-997-5p

Accession MIMAT0005517
Previous IDsdme-miR-997
Sequence

32 - 

cccaaacucgaaggaguuuca

 - 52

Get sequence
Deep sequencing589 reads, 13 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-997-3p

Accession MIMAT0020897
Sequence

165 - 

aaacucauucgauuuugauca

 - 185

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).