Stem-loop sequence dme-mir-998

AccessionMI0005860 (change log)
DescriptionDrosophila melanogaster miR-998 stem-loop
Gene family MIPF0000952; mir-998
Literature search

1 open access papers mention dme-mir-998
(142 sentences)

Stem-loop
   ccu     --c        u ug  a      u       gucugcacugacaacacugaccgcuccagggc 
5'    cgugu   aaauucau u  ga cugaau cucgugg                                a
      |||||   |||||||| |  || |||||| |||||||                                 
3'    guaca   uuuaagug g  cu gacuua gaguacc                                a
   uac     aac        c gu  c      -       acgaugucuuaaaguuaaaguuuuacuuguua 
Get sequence
Deep sequencing
78046 reads, 1.6e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 21621879-21622021 [-]
sense
FBtr0084118 ; E2f-RC; intron 5
FBtr0084119 ; E2f-RA; intron 5
FBtr0084117 ; E2f-RB; intron 7
Clustered miRNAs
< 10kb from dme-mir-998
dme-mir-11chr3R: 21622497-21622571 [-]
dme-mir-998chr3R: 21621879-21622021 [-]
Database links

Mature sequence dme-miR-998-5p

Accession MIMAT0020898
Sequence

24 - 

acugaauucucgugggucugca

 - 45

Get sequence
Deep sequencing45940 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-998-3p

Accession MIMAT0005518
Previous IDsdme-miR-998
Sequence

100 - 

uagcaccaugagauucagcuc

 - 120

Get sequence
Deep sequencing32026 reads, 49 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).