Stem-loop sequence dme-mir-1001

AccessionMI0005863 (change log)
DescriptionDrosophila melanogaster miR-1001 stem-loop
Gene family MIPF0001048; mir-1001
Literature search

3 open access papers mention dme-mir-1001
(4 sentences)

Stem-loop
   -aa        -    cu     aacu          a  uggag 
5'    gcuggccu gucc  gggua    cccaaggauc gg     a
      |||||||| ||||  |||||    |||||||||| ||      
3'    ugacugga cggg  cucgu    ggguuccuag cc     u
   uga        a    cu     cuuu          c  uaagu 
Get sequence
Deep sequencing
10685 reads, 90 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 27642466-27642555 [-]
sense
FBtr0331366 ; tau-RB; intron 6
FBtr0085197 ; tau-RA; intron 6
FBtr0331367 ; tau-RC; intron 6
FBtr0331368 ; tau-RD; intron 7
Database links

Mature sequence dme-miR-1001-5p

Accession MIMAT0005521
Previous IDsdme-miR-1001
Sequence

16 - 

uggguaaacucccaaggauca

 - 36

Get sequence
Deep sequencing10603 reads, 40 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-1001-3p

Accession MIMAT0020901
Sequence

55 - 

auccuuggguuucugcucucgg

 - 76

Get sequence
Deep sequencing82 reads, 24 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).