Stem-loop sequence dme-mir-1001

Accession

MI0005863 (change log)

Description

Drosophila melanogaster miR-1001 stem-loop

Gene family

MIPF0001048; mir-1001

Literature search

3 open access papers mention dme-mir-1001
(4 sentences)

Stem-loop

   -aa        -    cu     aacu          a  uggag 
5'    gcuggccu gucc  gggua    cccaaggauc gg     a
      |||||||| ||||  |||||    |||||||||| ||      
3'    ugacugga cggg  cucgu    ggguuccuag cc     u
   uga        a    cu     cuuu          c  uaagu 

Deep sequencing

10685 reads, 90 reads per million, 40 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3R: 27642466-27642555 [-]
• Overlapping transcripts:

  sense

  FBtr0331366 ; tau-RB; intron 6

  FBtr0085197 ; tau-RA; intron 6

  FBtr0331367 ; tau-RC; intron 6

  FBtr0331368 ; tau-RD; intron 7

Database links

• RNAcentral:URS0000794EC6_7227
• miRBase Tracker:MI0005863

Mature sequence dme-miR-1001-5p

• Accession: MIMAT0005521
• Previous IDs: dme-miR-1001
• Sequence: 16 - uggguaaacucccaaggauca - 36
• Deep sequencing: 10603 reads, 40 experiments
• Evidence: experimental; 454 [1]
• Database links:
  • RNAcentral:URS00003F2559_7227
• Predicted targets:
  • TargetScanFly:dme-miR-1001
  • microrna.org:dme-miR-1001-5p

Mature sequence dme-miR-1001-3p

• Accession: MIMAT0020901
• Sequence: 55 - auccuuggguuucugcucucgg - 76
• Deep sequencing: 82 reads, 24 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000010FB41_7227

References

1. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).