Stem-loop sequence dme-mir-1010

AccessionMI0005871 (change log)
DescriptionDrosophila melanogaster miR-1010 stem-loop
Gene family MIPF0000866; mir-1010
Literature search

2 open access papers mention dme-mir-1010
(2 sentences)

Stem-loop
   --        ---u    a        auuua      a 
5'   guaagugg    guag ugaaacaa     ccaaca u
     ||||||||    |||| ||||||||     ||||||  
3'   cguuuacc    uauc acuuuguu     gguugu u
   ga        uugc    c        ----a      u 
Get sequence
Deep sequencing
19830 reads, 263 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 22292879-22292949 [+]
sense
FBtr0084197 ; SKIP-RB; intron 17
FBtr0330381 ; SKIP-RI; intron 17
FBtr0305036 ; SKIP-RF; intron 18
FBtr0305037 ; SKIP-RG; intron 18
FBtr0301028 ; SKIP-RE; intron 18
Database links

Mature sequence dme-miR-1010-5p

Accession MIMAT0020905
Sequence

1 - 

guaagugguguagaugaaaca

 - 21

Get sequence
Deep sequencing1816 reads, 47 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-1010-3p

Accession MIMAT0005023
Previous IDsdme-miR-1010
Sequence

48 - 

uuucaccuaucguuccauuugcag

 - 71

Get sequence
Deep sequencing18013 reads, 49 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).