Stem-loop sequence dme-mir-1017

AccessionMI0005878 (change log)
DescriptionDrosophila melanogaster miR-1017 stem-loop
Literature search

4 open access papers mention dme-mir-1017
(4 sentences)

Stem-loop
   -----        -a         aaagcuucccauc 
5'      gugaguuu  guggaguuu             g
        ||||||||  |||||||||             c
3'      uacucaaa  caucucgaa             c
   ccccc        cc         agcgcauuaacga 
Get sequence
Deep sequencing
3007 reads, 95.3 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 24488612-24488682 [+]
sense
FBtr0084639 ; nAcRalpha-96Ab-RA; intron 4
FBtr0084640 ; nAcRalpha-96Ab-RB; intron 5
Database links

Mature sequence dme-miR-1017-3p

Accession MIMAT0005030
Previous IDsdme-miR-1017
Sequence

46 - 

gaaagcucuacccaaacucaucc

 - 68

Get sequence
Deep sequencing3002 reads, 43 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).