|
miRBase |
|
Stem-loop sequence mdv2-mir-M20 |
|
| Accession | MI0005888 |
| Description | Mareks disease virus type 2 miR-M20 stem-loop |
| Stem-loop |
c -a ug c uu a uc guccuu gcg gugc ugagau ua c || |||||| ||| |||| |||||| || a ag caggaa cgc caug acucug au c c cg gu a cu g |
Mature sequence mdv2-miR-M20-5p |
|
| Accession | MIMAT0004461 |
| Previous IDs | mdv2-miR-M20* |
| Sequence |
5 - uccuuagcguggugccugaga - 25 |
| Evidence | experimental; cloned [1], Solexa [2] |
Mature sequence mdv2-miR-M20-3p |
|
| Accession | MIMAT0004462 |
| Previous IDs | mdv2-miR-M20 |
| Sequence |
43 - ucaaguacugcgcgcaaggaccg - 65 |
| Evidence | experimental; cloned [1], Solexa [2] |
References |
|
| 1 |
PMID:17459919
"Marek's disease virus type 2 (MDV-2)-encoded microRNAs show no sequence conservation with those encoded by MDV-1"
J Virol. 81:7164-7170(2007).
|
| 2 |
PMID:19328516
"MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific"
Virology. 388:128-136(2009).
|