|
miRBase |
|
Mature sequence rno-miR-380-5p |
|
| Accession | MIMAT0005308 |
| Previous IDs | rno-miR-380 |
| Sequence |
11 - augguugaccauagaacaugcg - 32 |
| Evidence | experimental; cloned [1], SOLiD [2] |
| Predicted targets |
|
Mature sequence rno-miR-380-3p |
|
| Accession | MIMAT0017302 |
| Previous IDs | rno-miR-380* |
| Sequence |
47 - uauguaguaugguccacaucu - 67 |
| Evidence | experimental; SOLiD [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|