![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-495 |
||||||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0006152 (change log) | |||||||||||||||||||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-495 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000110; mir-329 | |||||||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
9 open access papers mention rno-mir-495 | |||||||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
--uac u u - --a u uuu 5' c gaaaagaagu gc ccauguu uuu ucgc u | |||||||||| || ||||||| ||| |||| 3' g uuuuucuuca cg gguacaa aag agug a cuaua c - u aca c uuu |
|||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-495 |
|
Accession | MIMAT0005320 |
Sequence |
49 - aaacaaacauggugcacuucuu - 70 |
Deep sequencing | 27922 reads, 337 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|