Stem-loop sequence tae-MIR159a

AccessionMI0006170 (change log)
Previous IDstae-miR159a
DescriptionTriticum aestivum miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

32 open access papers mention tae-MIR159a
(237 sentences)

Stem-loop
   -- ug        a   u     uga  -    uac   a   u   -u  a   g    u     guuc    uau         auuag 
5'   g  gagcuccu uca uccaa   ag gguc   cga ggg uug  gc gcu cuug ucaug    ccac   ccuaucucc     a
     |  |||||||| ||| |||||   || ||||   ||| ||| |||  || ||| |||| |||||    ||||   |||||||||      
3'   c  cucgaggg agu agguu   uc ccag   gcu ccc agc  cg cga gagc aguac    ggug   ggauagagg     a
   ua gu        a   u     -ug  g    -uc   -   u   uu  c   g    c     guuu    uuc         agcau 
Get sequence
Deep sequencing
172193689 reads, 8.24e+05 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
3D: 840138-840314 [-]
intergenic
Database links

Mature sequence tae-miR159a

Accession MIMAT0005343
Sequence

154 - 

uuuggauugaagggagcucug

 - 174

Get sequence
Deep sequencing172021691 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).