Stem-loop sequence tae-MIR159b

AccessionMI0006171 (change log)
DescriptionTriticum aestivum miR159b stem-loop
Gene family MIPF0000010; MIR159
Literature search

33 open access papers mention tae-MIR159b
(215 sentences)

Stem-loop
   -------                  aa     u   gc   -    c   ug    g     u    g uc    u      cu   uguucaucauucagcucgagaucugaaagaaacuacuccaauuua 
5'        gagcuccuuucgguccaa  agggg guu  ugu gggu gau  agcu cuggg caug a  ccgu agccua  cca                                             u
          ||||||||||||||||||  ||||| |||  ||| |||| |||  |||| ||||| |||| |  |||| ||||||  |||                                              
3'        cucgagggaaguuagguu  ucucc cag  aca ccca cua  ucga gaccc guac u  ggua ucggau  ggu                                             a
   ucuacgu                  --     -   gu   u    a   cg    g     c    g uc    u      ag   uguugcucaugagguaguaaaaggauagauguguguaugauaauc 
Get sequence
Deep sequencing
172022425 reads, 8.24e+05 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR159b

Accession MIMAT0005344
Sequence

230 - 

uuuggauugaagggagcucug

 - 250

Get sequence
Deep sequencing172022197 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).