Stem-loop sequence tae-MIR160

AccessionMI0006172 (change log)
DescriptionTriticum aestivum miR160 stem-loop
Gene family MIPF0000032; MIR160
Literature search

18 open access papers mention tae-MIR160
(75 sentences)

Stem-loop
   -----------------     u  aaaca    ga     c       c         cu    -   cu      ucccca 
5'                  agagg ga     augg  uaugc uggcucc uguaugcca  cgcg uag  gccaac      a
                    ||||| ||     ||||  ||||| ||||||| |||||||||  |||| |||  ||||||       
3'                  ucucu cu     ugcc  guacg accgagg gcgugcggu  gcgc auc  cgguug      a
   cucucucucucucucuc     -  cucuc    -a     a       a         ag    c   -u      cguucc 
Get sequence
Deep sequencing
69163 reads, 271 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
5B: 233412448-233412594 [+]
intergenic
Database links

Mature sequence tae-miR160

Accession MIMAT0005345
Sequence

22 - 

ugccuggcucccuguaugcca

 - 42

Get sequence
Deep sequencing66799 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).