Stem-loop sequence tae-MIR171a

AccessionMI0006175 (change log)
Previous IDstae-MIR171
DescriptionTriticum aestivum miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

19 open access papers mention tae-MIR171a
(66 sentences)

Stem-loop
   -------     u  u    au         u  a    c     -    -   ugccggccggccgua 
5'        uggaa gg cacu  gauguuggc cg cuca ucaga ccac gcc               g
          ||||| || ||||  ||||||||| || |||| ||||| |||| |||                
3'        acuuu uc guga  cuauaaccg gc gagu agucu ggug ugg               c
   cguacgu     c  -    cu         u  c    u     c    g   cguacgucuacguac 
Get sequence
Deep sequencing
73950 reads, 328 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
5A: 134091588-134091717 [-]
intergenic
Database links

Mature sequence tae-miR171a

Accession MIMAT0005348
Previous IDstae-miR171
Sequence

89 - 

ugauugagccgugccaauauc

 - 109

Get sequence
Deep sequencing71411 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).