Stem-loop sequence tae-MIR408

AccessionMI0006177 (change log)
DescriptionTriticum aestivum miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

14 open access papers mention tae-MIR408
(57 sentences)

Stem-loop
   auuuugugagu          ga     ---ca    u  agca    a     u      -a  aacaaaauuuaccaccugauuaugagaagagggagag 
5'            ggagaggggg  ggaga     ggga gg    gagc aggga gaggca  gc                                     a
              ||||||||||  |||||     |||| ||    |||| ||||| ||||||  ||                                      
3'            ucucuccccc  ccucu     cccu cc    cucg ucccu cuccgu  cg                                     g
   -----------          uc     cuaaa    c  ----    g     u      ca  ucccucccucguuguugucguugucuucgagaccguu 
Get sequence
Deep sequencing
15548 reads, 42.2 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR408

Accession MIMAT0005350
Sequence

136 - 

cugcacugccucuucccuggc

 - 156

Get sequence
Deep sequencing14868 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).