Stem-loop sequence tae-MIR1120a

AccessionMI0006182 (change log)
Previous IDstae-MIR1120
DescriptionTriticum aestivum miR1120 stem-loop
Gene family MIPF0000443; MIR1120
Literature search

12 open access papers mention tae-MIR1120a
(44 sentences)

Stem-loop
   -----g   cc  cc   c                c             ca         gu 
5'       cgg  gc  ggg agguacucccuccguc cauaauauaagaa  uuuuugaca  g
         |||  ||  ||| |||||||||||||||| |||||||||||||  |||||||||   
3'       guc  cg  ccc uuuaugagggaggcag guauuauauucuu  aaaaacugu  u
   cacuaa   cu  -a   -                a             ac         ga 
Get sequence
Deep sequencing
104563 reads, 105 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR504 in [1]. miR1120 is unrelated to mammalian miR-504;

Database links

Mature sequence tae-miR1120a

Accession MIMAT0005355
Previous IDstae-miR1120
Sequence

70 - 

acauucuuauauuaugagacggag

 - 93

Get sequence
Deep sequencing39053 reads, 116 experiments
Evidence experimental; cloned [1], RTPCR [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).