Stem-loop sequence tae-MIR1127a

AccessionMI0006189 (change log)
Previous IDstae-MIR1127
DescriptionTriticum aestivum miR1127 stem-loop
Gene family MIPF0000382; MIR1122
Literature search

7 open access papers mention tae-MIR1127a
(34 sentences)

Stem-loop
   ------        u   cucaac                       c   -      --    ------         aau  au 
5'       acauuaga gua      uacuccuuccguucggaauuacu guc caagaa  auaa      auguaucua   gc  u
         |||||||| |||      ||||||||||||||||||||||| ||| ||||||  ||||      |||||||||   ||   
3'       uguaaucu uau      augagggaggcaagccuuaauga cag guuuuu  uauu      uacauagau   ug  u
   cuaggu        -   ------                       a   u      ac    uuuacc         -gu  au 
Get sequence
Deep sequencing
268722 reads, 541 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR511 in [1]. miR1127 is unrelated to mammalian miR-511;

Genome context
Coordinates Overlapping transcripts
4B: 126057135-126057285 [+]
intergenic
Database links

Mature sequence tae-miR1127a

Accession MIMAT0005362
Previous IDstae-miR1127
Sequence

22 - 

uccuuccguucggaauuac

 - 40

Get sequence
Deep sequencing9576 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).