Stem-loop sequence cre-MIR1142

AccessionMI0006203 (change log)
DescriptionChlamydomonas reinhardtii miR1142 stem-loop
Stem-loop
     u         caa       -a  c           cu 
5' cg ggcaggggu   ggugugg  ug ggcaugggugg  a
   || |||||||||   |||||||  || |||||||||||   
3' gc ccguccccg   ucgcacc  ac ccguacccgcc  a
     c         acc       ag  -           cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cre-miR1142

Accession MIMAT0005376
Sequence

14 - 

aagguguggaugcggcauggg

 - 34

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).