Stem-loop sequence cre-MIR1143

AccessionMI0006204 (change log)
DescriptionChlamydomonas reinhardtii miR1143 stem-loop
Stem-loop
                a    aau      a     ggcagugguaccgccacugccuauauuuauauacuccgaaggaacuu 
5' aggacguccccuu cggg   auaaau uuagu                                               g
   ||||||||||||| ||||   |||||| |||||                                                
3' uccugcaggggaa gccc   uauuua aauca                                               u
                -    guu      a     ccuauaaauauauguuauuuauuuaaacaacggagcggauagccgau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cre-miR1143-5p

Accession MIMAT0005377
Previous IDscre-miR1143*
Sequence

1 - 

aggacguccccuuacggga

 - 19

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1143-3p

Accession MIMAT0005378
Previous IDscre-miR1143
Sequence

138 - 

uuauuugcccgaaggggacguccu

 - 161

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).