Stem-loop sequence cre-MIR1144a

AccessionMI0006205 (change log)
DescriptionChlamydomonas reinhardtii miR1144a stem-loop
Gene family MIPF0000432; MIR1144
Stem-loop
          -  ug a u  u     g      g      a         c  ga    g       ggcg     n   a              gcu   g ug u     --a ga    guu 
5' cggcggc gu  g c gc ggggu cagcag cuugga ccgggcacg ag  ggug guuuugu    gcagg agc ggcagcgcggggcu   ggu g  g ggagg   g  ugaa   c
   ||||||| ||  | | || ||||| |||||| |||||| ||||||||| ||  |||| |||||||    ||||| ||| ||||||||||||||   ||| |  | |||||   |  ||||    
3' gccgucg cg  c g ug cccca gucguu gaaccu ggccugugc uc  ccac caaaacg    cgucc uug ccgucguguccugg   cca c  c uuucc   c  acuu   g
          u  gu - c  u     a      a      c         c  ac    a       agga     g   c              ---   - gu -     caa aa    acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The predominant product from this hairpin precursor is named cre-miR1144a.1 here [1].

Database links

Mature sequence cre-miR1144a.2

Accession MIMAT0005379
Sequence

34 - 

uggaaccgggcacgcaggag

 - 53

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1144a.1

Accession MIMAT0005380
Sequence

77 - 

caggcagcgcggggcugcugg

 - 97

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).