Stem-loop sequence cre-MIR1145

AccessionMI0006206 (change log)
DescriptionChlamydomonas reinhardtii miR1145 stem-loop
Stem-loop
       a      aggg                c         a                                      g     a           c        g         a   cc        c                        u     a 
5' ccca cgugga    caugaccuccucccuu ugcagaccu ggucagaaggaccaggaccugcugggccccaaggucau gucgc augcuggucaa gccaccga agggucaac cca  cagcagcu ugggcggacaucaagcagaagacg ccucc g
   |||| ||||||    |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||| ||||||||| |||  |||||||| |||||||||||||||||||||||| |||||  
3' gggu gcaccu    guacuggaggagggaa acgucugga ccagucuuccugguccuggacgacccgggguuccagua cggcg uacgaccaguu cgguggcu ucccaguug ggu  gucgucga acccgccuguaguucgucuucugc ggagg c
       -      --ga                c         a                                      a     c           c        g         c   ua        c                        c     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Molner et al. identified several expressed products from this hairpin locus -- the predominant 2 are shown [1].

Database links

Mature sequence cre-miR1145.2

Accession MIMAT0005381
Sequence

208 - 

uggcguugacccugucggugg

 - 228

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1145.1

Accession MIMAT0005382
Sequence

255 - 

uuggggcccagcagguccugg

 - 275

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).