Stem-loop sequence cre-MIR1146

AccessionMI0006207 (change log)
DescriptionChlamydomonas reinhardtii miR1146 stem-loop
Stem-loop
   a       g  -c         ---ua   c  u 
5'  ugggucc au  gggaagcuu     uca ac c
    ||||||| ||  |||||||||     ||| || g
3'  acccggg ua  cccuucgaa     agu ug g
   -       g  ca         caaca   a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cre-miR1146

Accession MIMAT0005383
Sequence

1 - 

auggguccgaucgggaagcu

 - 20

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).