Stem-loop sequence cre-MIR1147

AccessionMI0006208 (change log)
DescriptionChlamydomonas reinhardtii miR1147 stem-loop
Stem-loop
      a                 c                   aa    a 
5' gcc uaauuagugccagcgcg ucucggccaagucuggcag  gcgg g
   ||| ||||||||||||||||| |||||||||||||||||||  |||| g
3' cgg guuaaucacggucgcgc agagccgguucagaccguc  cgcc a
      g                 a                   gc    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cre-miR1147.1

Accession MIMAT0005384
Sequence

10 - 

agugccagcgcgcucucggcc

 - 30

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1147.2

Accession MIMAT0005385
Sequence

23 - 

ucucggccaagucuggcaga

 - 42

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).