Stem-loop sequence cre-MIR1148

AccessionMI0006209 (change log)
DescriptionChlamydomonas reinhardtii miR1148 stem-loop
Stem-loop
                                 a   u               c    ---    gga  g a 
5' cagggacuguuuaccaacgugcagggggac ugg ggagauccuccuguc ggcu   accu   gc c a
   |||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||   ||||   || | g
3' gucccugacaaaugguugcacgucccccug auc ccucuaggaggacag ccga   ugga   cg g c
                                 a   n               a    uuu    gag  g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cre-miR1148.1

Accession MIMAT0005386
Sequence

14 - 

ccaacgugcagggggacaugg

 - 34

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1148.2

Accession MIMAT0005387
Sequence

35 - 

uggagauccuccuguccggcu

 - 55

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).