Stem-loop sequence cre-MIR1149

AccessionMI0006210 (change log)
DescriptionChlamydomonas reinhardtii miR1149 stem-loop
Stem-loop
       c    c      g                       c           aagg 
5' cgac gccu gggccc cuaugucggacaacaccgacccc agcccgccaac    a
   |||| |||| |||||| ||||||||||||||||||||||| |||||||||||    g
3' gcug cgga ccuggg gguacagucuguuguggcugggg ucgggcgguug    a
       a    c      a                       -           cggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_1: 5256729-5256842 [+]
intergenic
Database links

Mature sequence cre-miR1149.1

Accession MIMAT0005388
Sequence

23 - 

ucggacaacaccgacccccagc

 - 44

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1149.2

Accession MIMAT0005389
Sequence

83 - 

uguugucugacauggaggguc

 - 103

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).