Stem-loop sequence cre-MIR1150

AccessionMI0006211 (change log)
DescriptionChlamydomonas reinhardtii miR1150 stem-loop
Stem-loop
          c        ag                                    a                 c        a             u         c       -  u    c            c       c   -------- g        g            ---     ag       -----   -   a 
5' ggacgcg agcggagc  auccccgucauaccccgcuuggugcagcgcgucaau ucccucuuggcgagcuu gcaaauag gucggccccaguu ccgcugcag ugggcuu cg gcuu cagcuuccugca ggcucgc guc        c agcgccuu cuugccgcccga   uacgc  uucggau     ucg uau c
   ||||||| ||||||||  |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||| ||||||||| ||||||| || |||| |||||||||||| ||||||| |||        | |||||||| ||||||||||||   |||||  |||||||     ||| |||  
3' ccugcgc ucgccucg  uaggggcaguauggggcgaaccacgucgcguaguua agggagagccgcucgaa cguuuguc cagccggggucag ggcgacguc acccgaa gu cgaa gucgaaggacgu ccgagcg cag        g ucgcggaa gaacggugggcu   augcg  gagccua     agc aua g
          u        ca                                    c                 a        c             c         c       a  c    a            a       a   ucuccgaa g        g            acu     cu       acuca   u   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Molner et al. identified a number of offset and overlapping mature miRNA products frmo this hairpin precursor [1]. The predominant ones are named and shown here.

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_10: 1711645-1712042 [+]
intergenic
Database links

Mature sequence cre-miR1150.3

Accession MIMAT0005390
Sequence

295 - 

ugcagcggcgacuggggccga

 - 315

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1150.2

Accession MIMAT0005391
Sequence

331 - 

ucgccgagagggacauugau

 - 350

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1150.1

Accession MIMAT0005392
Sequence

337 - 

agagggacauugaugcgcugc

 - 357

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).