Stem-loop sequence cre-MIR1151a

AccessionMI0006212 (change log)
DescriptionChlamydomonas reinhardtii miR1151a stem-loop
Gene family MIPF0000415; MIR1151
Stem-loop
            g         g      a       a   -    a         c 
5' ccggccgcg caguccggg cucaua ccuguug cgc gcgc gcccgcggg a
   ||||||||| ||||||||| |||||| ||||||| ||| |||| ||||||||| g
3' ggccggcgc gucaggccc gggugu gggcaau gcg cgcg cgggcgucc u
            a         a      g       c   g    c         c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_10: 1934033-1934142 [+]
intergenic
Clustered miRNAs
< 10kb from cre-MIR1151a
cre-MIR1151ascaffold_10: 1934033-1934142 [+]
cre-MIR1151bscaffold_10: 1935781-1935924 [+]
Database links

Mature sequence cre-miR1151a-5p

Accession MIMAT0005393
Previous IDscre-miR1151a
Sequence

14 - 

uccggggcucauaaccuguug

 - 34

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1151a-3p

Accession MIMAT0005394
Previous IDscre-miR1151a*
Sequence

79 - 

acggggugugggacccgg

 - 96

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).