Stem-loop sequence cre-MIR1151b

AccessionMI0006213 (change log)
DescriptionChlamydomonas reinhardtii miR1151b stem-loop
Gene family MIPF0000415; MIR1151
Stem-loop
       u  g  c   uca      a  g         g              a   -    a         c 
5' gugg gu ug cgc   ccggcc cg caguccggg cucauaaccuguua cgc gcgc gcccgcagg a
   |||| || || |||   |||||| || ||||||||| |||||||||||||| ||| |||| ||||||||| g
3' cacc cg ac gug   ggucgg gc gucaggccc ggguguugggcaau gug cgcg cgggcgucc u
       c  g  a   uac      c  a         a              c   g    c         c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_10: 1935781-1935924 [+]
intergenic
Clustered miRNAs
< 10kb from cre-MIR1151b
cre-MIR1151ascaffold_10: 1934033-1934142 [+]
cre-MIR1151bscaffold_10: 1935781-1935924 [+]
Database links

Mature sequence cre-miR1151b-5p

Accession MIMAT0005395
Previous IDscre-miR1151b
Sequence

31 - 

uccggggcucauaaccuguua

 - 51

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1151b-3p

Accession MIMAT0005396
Previous IDscre-miR1151b*
Sequence

96 - 

acggguugugggacccggac

 - 115

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).