Stem-loop sequence cre-MIR1152

AccessionMI0006214 (change log)
DescriptionChlamydomonas reinhardtii miR1152 stem-loop
Stem-loop
                                                                cac 
5' ggggguauucacggcaccgucaagacggcgcaccuucuuaacguccuucggugcuugcuug   a
   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3' cuuccauaagugccguggcaguucugucgcguggaagaauugcgggaagccacggacgaac   c
                                                                uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_12: 1998777-1998906 [+]
intergenic
Database links

Mature sequence cre-miR1152

Accession MIMAT0005397
Sequence

91 - 

uaagaaggugcgcugucuuga

 - 111

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).