Stem-loop sequence cre-MIR1153

AccessionMI0006215 (change log)
DescriptionChlamydomonas reinhardtii miR1153 stem-loop
Stem-loop
                       u           ua    c          g              ug 
5' caaaugggccaucguauuac aucagugcugc  gcaa uacaaggcgg caugaaggucgauu  a
   |||||||||||||||||||| |||||||||||  |||| |||||||||| ||||||||||||||   
3' guuuacucgguagcguaaug uagucacgaug  cguu auguuccgcc guacuuccagcuag  u
                       u           gc    a          a              cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Molner et al. identify two miR/miR* pairs from the same hairpin precursor [1].

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_15: 1291877-1292010 [+]
intergenic
Database links

Mature sequence cre-miR1153-5p.1

Accession MIMAT0005398
Previous IDscre-miR1153.1
Sequence

5 - 

ugggccaucguauuacuaucag

 - 26

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1153-5p.2

Accession MIMAT0005399
Previous IDscre-miR1153.2*
Sequence

25 - 

agugcugcuagcaacuacaag

 - 45

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1153-3p.2

Accession MIMAT0005400
Previous IDscre-miR1153.2
Sequence

91 - 

uuguaauugccgguagcacuga

 - 112

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1153-3p.1

Accession MIMAT0005401
Previous IDscre-miR1153.1*
Sequence

111 - 

gauuguaaugcgauggcuc

 - 129

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).