Stem-loop sequence cre-MIR1154

AccessionMI0006216 (change log)
DescriptionChlamydomonas reinhardtii miR1154 stem-loop
   u      c                    a  c                 a           
5'  guaaug gggaaaaugguaacuuaguc uc caaggcguguaucaccc uguuacgggc 
    |||||| |||||||||||||||||||| || ||||||||||||||||| ||||||||| g
3'  cauugc cccuuuuaccauugaaucag ag guuccgcacauaguggg acaaugucca 
   a      u                    c  u                 c           
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_15: 1918568-1918688 [-]
Database links

Mature sequence cre-miR1154-5p

Accession MIMAT0005402
Previous IDscre-miR1154

21 - 


 - 40

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1154-3p

Accession MIMAT0005403
Previous IDscre-miR1154*

83 - 


 - 101

Get sequence
Evidence experimental; cloned [1]


PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).