Stem-loop sequence cre-MIR1155

AccessionMI0006217 (change log)
DescriptionChlamydomonas reinhardtii miR1155 stem-loop
Stem-loop
   u a     g      aa        c a     c      g       a 
5'  g ggcuc uuccuc  gcaggacu a agaac cgauca cuugucg g
    | ||||| ||||||  |||||||| | ||||| |||||| |||||||  
3'  c ccgag aaggag  cguccuga u uuuug gcuagu gaacagc c
   a c     g      ca        u c     u      g       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_15: 2058507-2058606 [+]
intergenic
Database links

Mature sequence cre-miR1155

Accession MIMAT0005404
Sequence

75 - 

uaguccugcacgaggaaggagc

 - 96

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).