Stem-loop sequence cre-MIR1156

AccessionMI0006218 (change log)
DescriptionChlamydomonas reinhardtii miR1156 stem-loop
Stem-loop
         c                      c   -caa       u       c   c                        u   a      a cau                          a        a 
5' ucugau ugccugaagcuccaguugaaac ugg    ggucgug gcccucu cac gacaugcgaggguccaccgccgug ggc caggcu c   gguagccagucugcgcaccugcagcc gcagcuga u
   |||||| |||||||||||||||||||||| |||    ||||||| ||||||| ||| |||||||||||||||||||||||| ||| |||||| |   |||||||||||||||||||||||||| |||||||| u
3' agacua acggacuucgaggucgacuuug acc    ccaguac cggggga gug cuguacgcucccagguggcggcac ccg guccga g   ccaucggucagacgcguggacgucgg ugucgacu c
         c                      -   cauc       u       a   c                        u   g      a cuu                          c        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_16: 1919702-1919968 [+]
intergenic
Database links

Mature sequence cre-miR1156.1

Accession MIMAT0005405
Sequence

196 - 

uggacccucgcauguccguga

 - 216

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1156.2

Accession MIMAT0005406
Sequence

241 - 

uucagcuggagcuucaggcac

 - 261

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).