Stem-loop sequence cre-MIR1158

AccessionMI0006220 (change log)
DescriptionChlamydomonas reinhardtii miR1158 stem-loop
Literature search

1 open access papers mention cre-MIR1158
(1 sentences)

Stem-loop
      gug  c   -                              c                 a     g  c              gu    u                      c                              a          c     g                           u               gacucggcgucggagccagggcccucggcucgagcaucagucguccgcgcugcu 
5' ggc   cg agc ggcggccgccgcggcugaggaagccaugau gaggcagcgcaggccac uugua gc ugccgcgcggcugu  cacc cugaccaggugcgacgggaagc gggcugcuggggcugcugcugaccgccagu gccuccucca gucuu ugcuagcuccgcaagcaccgcguccuc auguccgucaugucg                                                      g
   |||   || ||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||  |||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||                                                       
3' ccg   gc ucg ccgccggcggcgccgacuccuucgguacua cuccgucgcguccggug aacau cg acggcgcgccgaca  gugg gacugguccacgcugcccuucg cccgacgaccccgacgacgacuggcgguca cggaggaggu cagga acgaucgaggcguucguggcgcaggag uauaggcaguacagc                                                      c
      aga  u   g                              c                 c     a  a              gc    c                      a                              c          u     g                           u               nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Molner et al. cloned a number of minor products (cloned only once) from the loop end of this hairpin precursor (not shown) [1].

Database links

Mature sequence cre-miR1158

Accession MIMAT0005409
Sequence

363 - 

acuuggaggaggccacuggc

 - 382

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).