Stem-loop sequence cre-MIR1160

AccessionMI0006221 (change log)
DescriptionChlamydomonas reinhardtii miR1160 stem-loop
Stem-loop
                                                                                                                                                                                                    u  c     -----      c c   a 
5' uuugcaugcucucgcccgcuacacaaacacgaaugcucaaacgcucccuucccgcacggguccuuccggcugcgccggucaagccugcccugcuuaaaaagggcaaaguucgggcugacaaggaagcagagcggauccuccagagccucacagaccucaagaaggucggguucacaagcaaaugacgccugcu aa caggu     cguugc g cgg a
   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||     |||||| | ||| a
3' agacguacgagagcgggcgauguguuugugcuuacgaguuugcgagggaagggcgugcccaggaaggccgacgcggccaguucggacgggacgaauuuuucccguuucaagcccgacuguuccuucgucucgccuaggaggucucggagugucuggaguucuuccagcccaaguguucguuuacugcggacga uu guccg     gcgacg c gcu a
                                                                                                                                                                                                    -  c     acggu      a u   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_26: 727941-728377 [-]
intergenic
Database links

Mature sequence cre-miR1160.2

Accession MIMAT0005410
Sequence

116 - 

ugacaaggaagcagagcggau

 - 136

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1160.1

Accession MIMAT0005411
Sequence

332 - 

uugcccuuuuuaagcagggc

 - 351

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1160.3

Accession MIMAT0005412
Sequence

373 - 

aaggacccgugcgggaaggga

 - 393

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).