Stem-loop sequence cre-MIR1162

AccessionMI0006223 (change log)
DescriptionChlamydomonas reinhardtii miR1162 stem-loop
Literature search

1 open access papers mention cre-MIR1162
(1 sentences)

Stem-loop
       --  c      a             c  c                  c  cg  u  a        a 
5' gcgg  gg ccugac ccacugcggccgc gg cuaaauuacuacaacacg cg  cc gg cccgaggg g
   ||||  || |||||| ||||||||||||| || |||||||||||||||||| ||  || || |||||||| g
3' cgcc  cc ggacug gguggcgcuggcg cc gauuugaugauguugugc gc  gg cc gggcuccc a
       uu  u      g             u  c                  u  au  c  a        c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_3: 167785-167927 [-]
intergenic
Database links

Mature sequence cre-miR1162-5p

Accession MIMAT0005415
Previous IDscre-miR1162*
Sequence

28 - 

cggccuaaauuacuacaacacg

 - 49

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1162-3p

Accession MIMAT0005416
Previous IDscre-miR1162
Sequence

95 - 

uguuguaguaguuuagcccugc

 - 116

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).