Stem-loop sequence cre-MIR1163

AccessionMI0006224 (change log)
DescriptionChlamydomonas reinhardtii miR1163 stem-loop
Stem-loop
                                                    a                              c                                           c        -u    gcauagggucuuaacugccagguugaagucgcacacgcggaagaccuugcugccaucagg 
5' auugacaacgcgcccgagcgccggcgcaccggcaagaacaaggacaagu ugagaugcugccguaccccggcaacacgcu auggaugaggcugaccugaagggcaugcugcgugccauggcgc cuucaucg  gcgc                                                            c
   ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||  ||||                                                            g
3' uaacuguugcgcgggcucgcggccgcguggccguucuuguuccuguuca acucuacgacggcauggggccguugugcga uaccuacuccggcuggacuucccguacgacgcacgguaccgcg gaaguagu  cgug                                                            c
                                                    a                              a                                           a        uu    gacuugcgagcgccgauguacgugaaacuggacuucgggcgguuggacgacaugcuguag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_31: 330020-330419 [+]
intergenic
Database links

Mature sequence cre-miR1163.2

Accession MIMAT0005417
Sequence

101 - 

agggcaugcugcgugccaugg

 - 121

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1163.1

Accession MIMAT0005418
Sequence

273 - 

aagagcgccauggcacgcagc

 - 293

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).