Stem-loop sequence cre-MIR1164

AccessionMI0006225 (change log)
DescriptionChlamydomonas reinhardtii miR1164 stem-loop
Stem-loop
           u                         g         a                           --   u   g 
5' ggugcucu cuggugcaacaggccagugguuuga ugguggucg cggcaauugcuucagucuuacuugcuu  ggc uac u
   |||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||  ||| |||  
3' ucacgaga gaccacguuguccggucaccaaacu gccaccagc gucguuaacgaagucagaaugaacgaa  ccg aug a
           c                         a         c                           cu   c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_32: 259603-259766 [+]
intergenic
Database links

Mature sequence cre-miR1164

Accession MIMAT0005419
Sequence

11 - 

uggugcaacaggccagugguu

 - 31

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).