Stem-loop sequence cre-MIR1165

AccessionMI0006226 (change log)
DescriptionChlamydomonas reinhardtii miR1165 stem-loop
Stem-loop
     a     -                     cgccccauccugcguuugaaaacgcannnnnnnnnnn 
5' gc cuaua ccguacaagcgguccguccug                                     n
   || ||||| |||||||||||||||||||||                                      
3' cg gguau ggcauguucgccaggcaggac                                     n
     c     a                     nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cre-miR1165-5p

Accession MIMAT0005420
Previous IDscre-miR1165
Sequence

7 - 

uaccguacaagcgguccgucc

 - 27

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1165-3p

Accession MIMAT0005421
Previous IDscre-miR1165*
Sequence

110 - 

acggaccgcuuguacggauaug

 - 131

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).