Stem-loop sequence cre-MIR1166

AccessionMI0006227 (change log)
DescriptionChlamydomonas reinhardtii miR1166 stem-loop
Literature search

1 open access papers mention cre-MIR1166
(1 sentences)

Stem-loop
        --   -                c   cacag       c  c           c -a  a   a  a  -caa       a   c     g c    a                                           ---        uagcc  c       g      c   a     c 
5' gcaac  cac gccgcgcccugccggu ccc     uguauga uc uuuuaccgcua g  gg ugg cu ga    cccacgc ccg cuggu c gccg cucugcgccgggcccaugaggucauggaccucgcggcccugga   ggcccugg     gc gcgccau ccaggc guc gcgcg c
   |||||  ||| |||||||||||||||| |||     ||||||| || ||||||||||| |  || ||| || ||    ||||||| ||| ||||| | |||| |||||||||||||||||||||||||||||||||||||||||||   ||||||||     || ||||||| |||||| ||| ||||| g
3' cguug  gug cggcgcgggacggccg ggg     auaugcu ag aagauggcgau c  cc acc ga cu    gggugcg ggc gacca g cggc gagacgcggcccggguacuccaguaccuggagcgccgggaucu   ccgggacc     cg cgcggua gguccg cag cgcgc g
        au   g                c   aucca       u  u           a gg  -   g  g  acug       g   c     g u    c                                           ccg        -uuac  -       a      a   c     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Molner et al. cloned a number of additional minor products (cloned only once) from this hairpin precursor (not shown) [1].

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_36: 577911-578282 [-]
intergenic
Database links

Mature sequence cre-miR1166.1

Accession MIMAT0005422
Sequence

123 - 

uggaccucgcggcccuggagg

 - 143

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR1166.2

Accession MIMAT0005423
Sequence

240 - 

agguccaugaccucauggg

 - 258

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).